Journal: Frontiers in Molecular Neuroscience

Article Title: Endoplasmic Reticulum Stress in Spinal Cord Contributes to the Development of Morphine Tolerance

doi: 10.3389/fnmol.2018.00072

Figure Lengend Snippet: Primers for Real-time PCR.

Article Snippet: According to the previous literatures ( , ), recombinant shRNA lentiviral vectors targeting rat ATF6 gene (ATF6 RNAi-LV) and non-specific control lentivirus (NC-LV) were designed by Genechem (Shanghai, China).

Techniques: Sequencing

Journal: Frontiers in Molecular Neuroscience

Article Title: Endoplasmic Reticulum Stress in Spinal Cord Contributes to the Development of Morphine Tolerance

doi: 10.3389/fnmol.2018.00072

Figure Lengend Snippet: Expression of ATF6 in spinal cord. (A,B) The expression of ATF6 were significantly increased in morphine-tolerant rats measured by real-time PCR and western blots, respectively. ( ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared with naive rats, Real-time PCR: n = 4 in each group; western blots: n = 6 in each group). (C) Immunostaining of ATF6 in spinal dorsal horn. ATF6 was extensively expressed in spinal dorsal horn. The immunoreactivity of ATF6 was significantly increased in morphine-tolerant rats. ( ∗∗ p < 0.01 compared with naive rats, n = 3 in each group, scale bar: 200 μm). (D) Double immunostaining of ATF6 and cell-specific markers in morphine-tolerant rats. ATF6 was co-localized with NeuN (indicated by arrows), not with GFAP or Iba1 in spinal dorsal horn. Scale bar: 50 μm. (E) Chronic morphine administration results in ATF6 translocation to the nucleus. ATF6 was only expressed in cytoplasm in naive rats (indicated by arrows), while ATF6 was expressed in cytoplasm and cell nucleus in morphine-tolerant rats (indicated by arrows). Scale bar: 50 μm. ATF6, activating transcription factor 6; NS, normal saline; MT, morphine tolerance.

Article Snippet: According to the previous literatures ( , ), recombinant shRNA lentiviral vectors targeting rat ATF6 gene (ATF6 RNAi-LV) and non-specific control lentivirus (NC-LV) were designed by Genechem (Shanghai, China).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Immunostaining, Double Immunostaining, Translocation Assay, Saline

Journal: Frontiers in Molecular Neuroscience

Article Title: Endoplasmic Reticulum Stress in Spinal Cord Contributes to the Development of Morphine Tolerance

doi: 10.3389/fnmol.2018.00072

Figure Lengend Snippet: Effect of ATF6 RNAi-Lentivirus on the development of morphine tolerance. (A) Detection of lentivirus transfection in spinal cord. RNAi-LV or NC-LV was injected into lumbar spinal cord 3 days before intrathecal catheterization, respectively. The expression of enhanced green fluorescent protein in lentiviral vectors was detected in spinal dorsal horn n = 3 in each group. Scale bar: 100 μm. (B,C) RNAi-LV could effectively downregulate the expression of ATF6 induced by chronic morphine treatment measured by real-time PCR and western blots, respectively. ( ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared with naive rats, # p < 0.05, ## p < 0.01 compared with MT+NC-LV group, Real-time PCR: n = 4 in each group; western blots: n = 6 in each group). (D) Pretreatment with RNAi-LV could attenuate the development of morphine tolerance. ( ∗∗ p < 0.01 compared with MT group; ## p < 0.01 compared with MT+NC-LV group, n = 6–8 in each group). NS, normal saline; MT, morphine tolerance; ATF6, activating transcription factor 6; %MPE, percentage of maximal possible antinociceptive effect.

Article Snippet: According to the previous literatures ( , ), recombinant shRNA lentiviral vectors targeting rat ATF6 gene (ATF6 RNAi-LV) and non-specific control lentivirus (NC-LV) were designed by Genechem (Shanghai, China).

Techniques: Transfection, Injection, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Saline

Journal: Nature Communications

Article Title: Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice

doi: 10.1038/s41467-025-61219-w

Figure Lengend Snippet: a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

Article Snippet: AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively.

Techniques: Gene Expression, Injection, Labeling